View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0582_high_7 (Length: 257)
Name: NF0582_high_7
Description: NF0582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0582_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 3 - 228
Target Start/End: Original strand, 50993611 - 50993842
Alignment:
| Q |
3 |
ttgattcggcggtggctgcaaatgctgttcccgtggctgtggctgcaccggtttcagaggtggttggtgatgaggaggtttatatttatgatagtaacag |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50993611 |
ttgattcggcggtggctgcaaatgctgttcccgtggctgtggccgcaccggtttcagaggtggttggtgatgaggaggtttatatttatgatagtaacag |
50993710 |
T |
 |
| Q |
103 |
gaaagtgagtggtgaagatgagttgttttctgatttggagaaggatgataatgttctttcacctgttccaa------tttcagtatcagagaagcagttt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
50993711 |
gaaagtgagtggtgaagatgagttgttttctgatttggagaaggatgataatgttctttcacctgttccaatatcagtatcagtatcagagaagcagttt |
50993810 |
T |
 |
| Q |
197 |
attccactcctcagtggcttacaaggagaagg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
50993811 |
attccactcctcagtggcttacaaggagaagg |
50993842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 71 - 150
Target Start/End: Complemental strand, 6526771 - 6526692
Alignment:
| Q |
71 |
gatgaggaggtttatatttatgatagtaacaggaaagtgagtggtgaagatgagttgttttctgatttggagaaggatga |
150 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
6526771 |
gatgaggaggttcatatttatgatagtaataggaaagtgagtggtgaagatgggttgttttctgattttgagaaggatga |
6526692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University