View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0582_low_11 (Length: 311)
Name: NF0582_low_11
Description: NF0582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0582_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 31 - 244
Target Start/End: Complemental strand, 3646197 - 3645984
Alignment:
Q |
31 |
tctttatagaccatataacttttgttgtaaaaggtttcctagttagtgacggaggtaaataattgtttacagtattttgttgatacttgatatttagtgg |
130 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |||||| |||||||||||||||||||||||||||||| |
|
|
T |
3646197 |
tctttatagaccatataacttttgttgtaaaaggtttcctagttagtgacggaggtaa-tgactgtttagagtattttgttgatacttgatatttagtgg |
3646099 |
T |
 |
Q |
131 |
atcatt-aactttacctaaaaaaggaaaacttggtcattccttgatttcttgattaccctaccaaatatagaaagatatgataccgcatgaacaggaccc |
229 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
3646098 |
atcatttaactttacctaaaaaaggaaaacttggtcattccttgatttcatgattaccctaccaaatatagaaagatatgatatcgcatgaacaggaccc |
3645999 |
T |
 |
Q |
230 |
atactgtcttatact |
244 |
Q |
|
|
||||||||||||||| |
|
|
T |
3645998 |
atactgtcttatact |
3645984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 241 - 300
Target Start/End: Complemental strand, 3645704 - 3645649
Alignment:
Q |
241 |
tactaccgtgatttgtgtgtggtcgtcaaagtaacaacaagcatacatagatttattcat |
300 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3645704 |
tactaccgtgatt----tgtggtcgtcaaagtaacaacaagcatacatagatttattcat |
3645649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University