View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0582_low_12 (Length: 271)
Name: NF0582_low_12
Description: NF0582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0582_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 31 - 148
Target Start/End: Complemental strand, 46525414 - 46525300
Alignment:
Q |
31 |
agcagagacaagaggcaaacaacaactagccagcatagtgaaacaaaatttgaagcttgtttctctgcttagatatccggacattgttgtacaatacatt |
130 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46525414 |
agcagagacaagaggcaaacaacaactagccagcatagtgaaacaaaatttgaagcttgtttctctgcttagatatccggacattgttgtacaataca-- |
46525317 |
T |
 |
Q |
131 |
gttgcatgaaacaacttg |
148 |
Q |
|
|
||||||||||||||||| |
|
|
T |
46525316 |
-ttgcatgaaacaacttg |
46525300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 625 times since January 2019
Visitors: 3836