View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0582_low_13 (Length: 263)
Name: NF0582_low_13
Description: NF0582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0582_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 17304154 - 17304313
Alignment:
Q |
1 |
gaacggtgcttcttgagacggcggatgatgcgaaaggcggcggcgg---aggcggagagggtgagatgatggaaggccgtattttgcggcggtttgaaag |
97 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17304154 |
gaacggtgcttcttgagacggcggatgatgcgaaaggcggtggcggcagaggcggagagggtgagatgatggaaggccgtattttgcggcggtttgaaag |
17304253 |
T |
 |
Q |
98 |
gcggtttgttagaaggacgggtgatgatttctgttggggatatgtcgatggagtgatgac |
157 |
Q |
|
|
|| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
17304254 |
gcagtttgttagaaggacgggtgatgatttctgttggggagatgtcgatggagtgatgac |
17304313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University