View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0582_low_13 (Length: 263)

Name: NF0582_low_13
Description: NF0582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0582_low_13
NF0582_low_13
[»] chr7 (1 HSPs)
chr7 (1-157)||(17304154-17304313)


Alignment Details
Target: chr7 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 17304154 - 17304313
Alignment:
1 gaacggtgcttcttgagacggcggatgatgcgaaaggcggcggcgg---aggcggagagggtgagatgatggaaggccgtattttgcggcggtttgaaag 97  Q
    |||||||||||||||||||||||||||||||||||||||| |||||   |||||||||||||||||||||||||||||||||||||||||||||||||||    
17304154 gaacggtgcttcttgagacggcggatgatgcgaaaggcggtggcggcagaggcggagagggtgagatgatggaaggccgtattttgcggcggtttgaaag 17304253  T
98 gcggtttgttagaaggacgggtgatgatttctgttggggatatgtcgatggagtgatgac 157  Q
    || ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
17304254 gcagtttgttagaaggacgggtgatgatttctgttggggagatgtcgatggagtgatgac 17304313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 988 times since January 2019
Visitors: 3838