View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0582_low_16 (Length: 251)
Name: NF0582_low_16
Description: NF0582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0582_low_16 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 108 - 251
Target Start/End: Original strand, 3645084 - 3645230
Alignment:
Q |
108 |
ttataacatgattgttattgcattgggaattatcgtagacgtgttttcaatacaaagctacactttgtaccttctattattcattgtgattggtgaaaac |
207 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3645084 |
ttatatcatgattgttattgcattgggaattatcgtagacgtgttttcaatacaaagctacactttgtaccttctattattcattgtgattggtgaaaac |
3645183 |
T |
 |
Q |
208 |
gatctcataac---atgataatcgcaagtttgaagaagtacttagca |
251 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
3645184 |
gatctcataacatgatgataatcgcaagtttgaagaagtacttagca |
3645230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University