View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0582_low_8 (Length: 329)
Name: NF0582_low_8
Description: NF0582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0582_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 83 - 235
Target Start/End: Complemental strand, 33624030 - 33623878
Alignment:
| Q |
83 |
acagaaagagattctagaaacagttgttatgaatcttccaccggaaaagaatctgaattcgtcaacagcaacaaggtttctattcggattgttacgaact |
182 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33624030 |
acagaaagagatactagaaacagttgttatgaatcttccaccggaaaagaatctgaattcgtcaacagcaacaaggtttctatttggattgttacgaact |
33623931 |
T |
|
| Q |
183 |
gcgaatatactaaacgcttcagaatcatgtagaaacgctttggagaagaaaat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33623930 |
gcgaatatactaaacgcttcagaatcatgtagaaacgctttggagaagaaaat |
33623878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2134 times since January 2019
Visitors: 3811