View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_high_103 (Length: 251)
Name: NF0583_high_103
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_high_103 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 45952230 - 45952451
Alignment:
| Q |
1 |
ttgtgataccatcatgaattcacgaccttcaagaatgatcaaatagtccattcaattcctttaaccttagtatatccaaagcataacccttgagtttata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45952230 |
ttgtgataccatcatgaattcacgaccttcaagaatgatcaaatagtccattcaattcctttaaccttagtatatccaaagcataacccttgagtttata |
45952329 |
T |
|
| Q |
101 |
ccattttttgtgcgtttaaccctagtatggtgcctatatataaagttttggagtgtgaacctaataaaatcaaaccaaacacattttatggaagaagcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45952330 |
ccattttttgtgcgtttaaccctagtatggtgcctatatataaagttttggagtgtgaacctaataaaatcaaaccaaacacattttatggaagaagcca |
45952429 |
T |
|
| Q |
201 |
tgatgagtaagattgctaatat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45952430 |
tgatgagtaagattgctaatat |
45952451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3123 times since January 2019
Visitors: 3831