View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_high_104 (Length: 251)
Name: NF0583_high_104
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0583_high_104 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 30 - 251
Target Start/End: Complemental strand, 48418619 - 48418395
Alignment:
Q |
30 |
ttcttcttctgctgccagatctgaggcctttcgccgtatggagaaacaatttcatgctcttcaacttcaaccctttcaagacaatggagtttctcaacaa |
129 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
48418619 |
ttcttcttctgctgccagatctgaggcctttcgccgtatggagaaacaatttcatgctcttcaacttcaacccttgcaagacaatggagtttctcaacaa |
48418520 |
T |
 |
Q |
130 |
ggtacttttattcatcaacaaccttataatactcaagttcaagatgtgggaaccttctgttctaat---gttgtccaacaacaacaccctagtaattatc |
226 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
48418519 |
ggtacttttattcatcaacaaccttataatactcaagttcaagatgtgggaaccttcggttctaataccgttgtccaacaacaacaccctagtaattatc |
48418420 |
T |
 |
Q |
227 |
aacacggttttataaataattatgc |
251 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
48418419 |
aacacggttttataaataattatgc |
48418395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University