View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_high_108 (Length: 238)
Name: NF0583_high_108
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_high_108 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 78 - 234
Target Start/End: Original strand, 33861215 - 33861371
Alignment:
| Q |
78 |
aaataaatgaaggctattatgttcaatctccaattctcatgatcatttagataattatacatataaatcaccatcataacaaagaaagcaatcaaatctg |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33861215 |
aaataaatgaaggctattatgttcaatctccaattctcatgatcatttagatatttatacatataaatcaccatcataacaaagaaagcaatcaaatctg |
33861314 |
T |
|
| Q |
178 |
tttcgaactttgataatgtacaaggaaattagggtagcaagaattatatgtgaccca |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33861315 |
tttcgaactttgataatgtacaaggaaattagggtagcaagaattatatgtgaccca |
33861371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1164 times since January 2019
Visitors: 3841