View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_high_110 (Length: 233)
Name: NF0583_high_110
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_high_110 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 22 - 211
Target Start/End: Original strand, 1755527 - 1755716
Alignment:
| Q |
22 |
acaattttaacgaccaagaaagattcgatcaagtagccagtgtctcgttattattatgcttgttgttgatcctcttccctgccttaaaggctgcaacaga |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1755527 |
acaattttaacgaccaagaaagattcgatcaagtagccagtgtctcgttattattatgcttgttgctgatcctcttccctgccttaaaggctgcaacaga |
1755626 |
T |
|
| Q |
122 |
tggcgataacattgcaaaacatcacactttcctgacaatttaccacaccacttttgttttggtgaatcagtcatatctatttagtattat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1755627 |
tggcgataacattgcaaaacatcacactttcctgacaatttaccacaccacttttgttttggtgaatcagtcatatctatttagtgttat |
1755716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 22 - 211
Target Start/End: Complemental strand, 1766223 - 1766034
Alignment:
| Q |
22 |
acaattttaacgaccaagaaagattcgatcaagtagccagtgtctcgttattattatgcttgttgttgatcctcttccctgccttaaaggctgcaacaga |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1766223 |
acaattttaacgaccaagaaagattcgatcaagtagccagtgtctcgttattattatgcttgttgctgatcctcttccctgccttaaaggctgcaacaga |
1766124 |
T |
|
| Q |
122 |
tggcgataacattgcaaaacatcacactttcctgacaatttaccacaccacttttgttttggtgaatcagtcatatctatttagtattat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1766123 |
tggcgataacattgcaaaacatcacactttcctgacaatttaccacaccacttttgttttggtgaatcagtcatatctatttagtgttat |
1766034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1433 times since January 2019
Visitors: 3846