View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_high_112 (Length: 229)
Name: NF0583_high_112
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0583_high_112 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 32396515 - 32396313
Alignment:
Q |
18 |
agttgtaccatttctaatcaaacttaggcttgaaggtggccatataaattgctaatcctgaaattttctatcatattaaagtaaggcttggaggcaaaac |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32396515 |
agttgtaccatttctaatcaaacttaggcttgaaggtggccatataaattgctaatcctgaaattttctatcatattaaagtaaggcttggaggcaaaac |
32396416 |
T |
 |
Q |
118 |
aaattttgccatacaacaatcaaatacatgtaaaattatatttgtagaaagtaaaatcaatttgtaaaaccaagcacacccctatttttccccctttgtt |
217 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
T |
32396415 |
aaattttgccatacaacaatcaaatacatgtaaaattatatttgtagaaagtaaaatcaatttgtaaaaccaagcacacccctattttcccctctttgtt |
32396316 |
T |
 |
Q |
218 |
tct |
220 |
Q |
|
|
||| |
|
|
T |
32396315 |
tct |
32396313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University