View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_high_44 (Length: 379)
Name: NF0583_high_44
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_high_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 198 - 368
Target Start/End: Original strand, 52888192 - 52888362
Alignment:
| Q |
198 |
cttcccatcctcaatatgcaattcttaattcctttttgaatttcacttctccgttgtcactgtttattactcgcaaccacttgccaaaaatgtcttcgtg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
52888192 |
cttcccatcctcaatatgcaattcttaattcctttttgaatttcacttctcctttgtcactgtttattacttgcaaccacttgccaaaaatgtcttcttg |
52888291 |
T |
 |
| Q |
298 |
ttttagtggaacaggaggaagaaccatcggtttggatttagatatagttaaatcatcaccaccatgttcat |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52888292 |
ttttagtggaacaggaggaagaaccatcggtttggatttagatatagttaaatcatcaccaccatgttcat |
52888362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 94; Significance: 8e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 7 - 104
Target Start/End: Original strand, 1755528 - 1755625
Alignment:
| Q |
7 |
caattttaacgaccaagaaagattcgatcaagtagccagtgtctcgttattattatgcttgttgttgatcctcttccctgccttaaaggctgcaacag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1755528 |
caattttaacgaccaagaaagattcgatcaagtagccagtgtctcgttattattatgcttgttgctgatcctcttccctgccttaaaggctgcaacag |
1755625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 7 - 104
Target Start/End: Complemental strand, 1766222 - 1766125
Alignment:
| Q |
7 |
caattttaacgaccaagaaagattcgatcaagtagccagtgtctcgttattattatgcttgttgttgatcctcttccctgccttaaaggctgcaacag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1766222 |
caattttaacgaccaagaaagattcgatcaagtagccagtgtctcgttattattatgcttgttgctgatcctcttccctgccttaaaggctgcaacag |
1766125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University