View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_high_47 (Length: 364)
Name: NF0583_high_47
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0583_high_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 13 - 271
Target Start/End: Complemental strand, 54416214 - 54415956
Alignment:
Q |
13 |
aatatggatgtgggtttcatgagtaattcatatgctagtgatccgtaataagagtataaaaatcaaagggaagcaaagtaacaagtaaaatttgatgtta |
112 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54416214 |
aatatggatgtgggtttcatgagtaattcatatgctagtgatccataataagagtataaaaatcaaagggaagcaaagtaacaagtaaaatttgatgtta |
54416115 |
T |
 |
Q |
113 |
atcactcgaaaattaccgctggatgtgtggaaggggagtagggagcctgtgtttaccttatatagcttataagcccacagccaataacaattcataacta |
212 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54416114 |
atcactcgtaaattaccgctggatgtgtggaaggggagtagggagcctgtgtttaccttatatagcttataagcccacagccaataacaattcataacta |
54416015 |
T |
 |
Q |
213 |
actgactggagttagcagctgtattgtcaatacagtattgacaggagcactggatgtgc |
271 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54416014 |
actgactggagttggcagctgtattgtcaatacagtattgacaggagcactggatgtgc |
54415956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University