View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_high_55 (Length: 342)
Name: NF0583_high_55
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0583_high_55 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 23 - 314
Target Start/End: Complemental strand, 10279946 - 10279655
Alignment:
Q |
23 |
atcatcaagctcaagactcttttgcatccgatcaagaactgctctaccgcccgtatgcatgcaaaattgatcgaacgctaacttgaaatttggcatgtat |
122 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10279946 |
atcatcaagctcaagactcttttgcatccgatcaagaactgctctaccgcccgtatgcatgcaaaattgatcgaacgctaacttgaaatttggcatgtat |
10279847 |
T |
 |
Q |
123 |
ggttcgatcttcttcttcaaaatcttcctctcaactaaatttttcacatacttgagtttttccgaaattgggaggactaatggaccgagcgatgttatgt |
222 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10279846 |
ggttcgatcttcttcttcaaaatcttcctctcaactaaatttttcacatacttgagtttttccgaaattgggaggactaatggaccgagcgatgttatgt |
10279747 |
T |
 |
Q |
223 |
gtacacgaagtgcgtccctagcaacattcatgagatccttcgatagtttaacaccgactatttctttttcgtcctcttcctgaaagacgcat |
314 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10279746 |
gtacacgaagtgcgtccctagcaacattcatgagatccttcgatagtttaacaccgactatttctttttcgtcctcttcctgaaagacgcat |
10279655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University