View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_high_56 (Length: 340)
Name: NF0583_high_56
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_high_56 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 52 - 224
Target Start/End: Complemental strand, 161743 - 161574
Alignment:
| Q |
52 |
tttgttctgccagattcatgaatgaggaggcttctctgttgataattgttgcattaatggttatctctcaacatatgtaatgatttattactccttcttt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
161743 |
tttgttctgccagattcatgaatgaggaggcttctctgttgataattgttgcattaatggttatctctcaacatatgtaatgatttattactccttcttt |
161644 |
T |
|
| Q |
152 |
cttcttctgaagtacatgagaaactagcattgatttactctactgatggtatgggttttatagacaaactatc |
224 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
161643 |
c---ttctgaagtacatgagaaactagcattgatttactctattgatggtatgggttttatagacaaactatc |
161574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 220 - 322
Target Start/End: Complemental strand, 161549 - 161447
Alignment:
| Q |
220 |
ctatctaatgtgttgtgtggaggttggaactttgcttcatgccattcgagattgtattcatgctaatttgttgtttttatattcatgttgtctttttggg |
319 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
161549 |
ctatctaatgtgttgtgtggaggttagaactttgcttcatgccattcgagactgtattcatgctaatttgttgtttttatattgatgttgtctttttggg |
161450 |
T |
|
| Q |
320 |
ttt |
322 |
Q |
| |
|
||| |
|
|
| T |
161449 |
ttt |
161447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1603 times since January 2019
Visitors: 3849