View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_high_57 (Length: 340)
Name: NF0583_high_57
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0583_high_57 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 75 - 338
Target Start/End: Original strand, 31612730 - 31612993
Alignment:
Q |
75 |
gatggtaccttgttcgaggacgaatcaaagaagccatgaacatcatgtccactatagctacctctaatggcaaccaccttccacacagagtttttctcac |
174 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31612730 |
gatggtaccttgttcgaggacgaatcaaagaagccatgaacatcatgtccactatagctacctctaatggcaaccaccttccacacagagtttttctcac |
31612829 |
T |
 |
Q |
175 |
actcgacgaagaaccatcatcatgtaataacaatatggatgacaaagatgcagtgacaggatctctggtggacgtgattcattcaccagtaacacggacg |
274 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| || |
|
|
T |
31612830 |
actcgacgaagaaccatcatcatgtaataacaatatggatgacaaagatgcagtgacaggatctctggtggatgtgattcgttcaccagtaacacgtaca |
31612929 |
T |
 |
Q |
275 |
cggttggttttagcaacaattatcaacttattgtgctcagtggtgtactatggtctaagcctaa |
338 |
Q |
|
|
|| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31612930 |
cgtttggttttagcaacaatcatcaacttattgtgctcagtggtgtactatggtctaagcctaa |
31612993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University