View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_high_64 (Length: 313)
Name: NF0583_high_64
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_high_64 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 42393416 - 42393200
Alignment:
| Q |
1 |
acccttccatttgggagaaaccgttagaatttgatccgacaaggttcttggatggtaaatgggattataaagggaatgactttaattatttcccctttgg |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42393416 |
acccttccatttgggagaaaccgctagaatttgatccgacaaggttcttggatggtaaatgggattataaagggaatgacttcaattatttcccctttgg |
42393317 |
T |
 |
| Q |
101 |
ttctggaagaaggatatgtgctggaatagcaatggctgagaggaatgttttgtactttatagccacccttatgcactcgtttgattggacaatacctcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42393316 |
ttctggaagaaggatatgtgctggaatagcaatggctgagaggaatgttttgtactttatagccacccttatgcactcgtttgattggacaatacctcaa |
42393217 |
T |
 |
| Q |
201 |
ggagaaaagttggatgt |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
42393216 |
ggagaaaagttggatgt |
42393200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 10 - 208
Target Start/End: Complemental strand, 42376855 - 42376657
Alignment:
| Q |
10 |
tttgggagaaaccgttagaatttgatccgacaaggttcttggatggtaaatgggattataaagggaatgactttaattatttcccctttggttctggaag |
109 |
Q |
| |
|
|||||||||| || ||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| || |||||||| ||||| |||||||| |
|
|
| T |
42376855 |
tttgggagaacccactagaatttgatcctacaaggttcttggatggtaaatgggattatagtgggaatgacttcaactatttcccttttggctctggaag |
42376756 |
T |
 |
| Q |
110 |
aaggatatgtgctggaatagcaatggctgagaggaatgttttgtactttatagccacccttatgcactcgtttgattggacaatacctcaaggagaaaa |
208 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| |||||||||||| ||||||||||| |||||| ||||||||||||| | |||||||||||||| |
|
|
| T |
42376755 |
aaggatttgtgccggaatagcaatggctgagaggacggttttgtactttgtagccacccttgtgcacttgtttgattggacagttcctcaaggagaaaa |
42376657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 41 - 217
Target Start/End: Complemental strand, 42387220 - 42387044
Alignment:
| Q |
41 |
aaggttcttggatggtaaatgggattataaagggaatgactttaattatttcccctttggttctggaagaaggatatgtgctggaatagcaatggctgag |
140 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| || |||||||| ||||| |||||||||||||| ||||| |||||||||||| ||||| |
|
|
| T |
42387220 |
aaggttcttggatggtaaatgggattatagtgggaatgacttcaactatttcccttttggctctggaagaaggatttgtgccggaatagcaatgtctgag |
42387121 |
T |
 |
| Q |
141 |
aggaatgttttgtactttatagccacccttatgcactcgtttgattggacaatacctcaaggagaaaagttggatgt |
217 |
Q |
| |
|
|||| |||||||||||| ||||||||||| |||||| ||||||||||||| | |||||||||||||| ||||||| |
|
|
| T |
42387120 |
aggacggttttgtactttgtagccacccttgtgcacttgtttgattggacagttcctcaaggagaaaatatggatgt |
42387044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University