View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_high_73 (Length: 288)
Name: NF0583_high_73
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_high_73 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 27 - 288
Target Start/End: Original strand, 32396150 - 32396411
Alignment:
| Q |
27 |
tcaccaccacaaagggtctaagctcttaacatttaatagcttccacacaaatctaaccaaatgtcgggggaccatgaaaagtggacataggtaatagacc |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32396150 |
tcaccaccacaaagggtctaagctcttaacttttaatagcttccacacaaatctaaccaaatgccgggggaccatgaaaagtggatataggtaatagacc |
32396249 |
T |
 |
| Q |
127 |
ttgactttatcatgccttaggcgagccccgcaaaatcaatttcagcatataagccaatcaaacagaaacaaagagggaaaaataggggtgtgcttggttt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32396250 |
ttgactttatcatgccttaggcgagccccgcaaaatcaatttcagcatataagccaatcaaacagaaacaaagaggggaaaataggggtgtgcttggttt |
32396349 |
T |
 |
| Q |
227 |
tacaaattgattttactttctacaaatataattttacatgtatttgattgttgtatggcaaa |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32396350 |
tacaaattgattttactttctacaaatataattttacatgtatttgattgttgtatggcaaa |
32396411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University