View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_high_81 (Length: 280)
Name: NF0583_high_81
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0583_high_81 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 46 - 273
Target Start/End: Complemental strand, 6626238 - 6626011
Alignment:
Q |
46 |
gaggaattttcaggaagaaagaagaaaaacatcttatgtgttacctagcataaccttccattctctactttttctttcaggtggaatggattgcatccat |
145 |
Q |
|
|
||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
6626238 |
gaggaattttcagaaagaaagaagaaaaacatattatgtgttacctagcataaccttccattctctactttttctttcaggtggaatggattccatccat |
6626139 |
T |
 |
Q |
146 |
tgctcatttcttgagcttttcgttcattccttactggcttattggttgtacgtacacacgttgaggtagttttattgatacatagagtcttttcaagcga |
245 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
T |
6626138 |
tgctcatttcttgagcttttcgttcattccttacttgcttattggttgtacgtacacacgttgaggtagttttattggtacatagagccttttcaagcga |
6626039 |
T |
 |
Q |
246 |
ctctttatgtttataatatcctatgcta |
273 |
Q |
|
|
||||||||||||||||||||||| |||| |
|
|
T |
6626038 |
ctctttatgtttataatatcctacgcta |
6626011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 130 - 273
Target Start/End: Complemental strand, 6791513 - 6791370
Alignment:
Q |
130 |
aatggattgcatccattgctcatttcttgagcttttcgttcattccttactggcttattggttgtacgtacacacgttgaggtagttttattgatacata |
229 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
6791513 |
aatggattccatccattgctcatttcttgagcttttcgttcattccttacttgcttattggttgtacgtacacacgttgaggtagttttattggtacata |
6791414 |
T |
 |
Q |
230 |
gagtcttttcaagcgactctttatgtttataatatcctatgcta |
273 |
Q |
|
|
||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
6791413 |
gagccttttcaagcgactctttatgtttataatatcctacgcta |
6791370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1471 times since January 2019
Visitors: 3846