View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_high_88 (Length: 265)
Name: NF0583_high_88
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_high_88 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 14786864 - 14786629
Alignment:
| Q |
1 |
cgacttaattgtctacttggtggaatcnnnnnnngttgcaaaaagtaaatcaatggtgatttatagaacttttaaatttttgtataccaataattttaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14786864 |
cgacttaattgtctacttggtggaatctttttttgttgcaaaaagtaaatcaatggtgatttatagaacttttaaatttttgtatgccaataattttaat |
14786765 |
T |
 |
| Q |
101 |
caacatctgatttatcaaatggttcatttgtcagagtgcctactgccttgtcatccagcatttctagggaaataactatcatttcatatagtcatcgata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14786764 |
caacatctgatttatcaaatggttcatttgtcagagtgcctactgccttgtcatccagcatttctagggaaataactatcatttcatatagtcatcgata |
14786665 |
T |
 |
| Q |
201 |
aattttaagcctgaacaaagattgaatctaccgggg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
14786664 |
aattttaagcctgaacaaagattgaatctaccgggg |
14786629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University