View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_high_89 (Length: 264)
Name: NF0583_high_89
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_high_89 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 6909642 - 6909408
Alignment:
| Q |
1 |
aaataagatgttcaattatcattcaacttttaaagttttgaatgannnnnnnnngtcgtgtttaaaatatttcttcacataaaaataatatgaatctttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6909642 |
aaataagatgttcaattatcattcaacttttaaatttttgaatgaattttttttgtcgtgtttaaaatatttcttcacataaaaataatatgaatcttcc |
6909543 |
T |
|
| Q |
101 |
aaacgtcaaaagctctaaagaaaagcaacaaaatttggacatagaaattaatttttgaggtcagattttgtgcgggaactttttatagtgttctaaaaat |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6909542 |
aaacatcaaaagctctaaagaaaagcaacaaaatttggacatagaaactaatttttgaggtcagattttgtgcgggaactttttatagtgttctaaaaat |
6909443 |
T |
|
| Q |
201 |
gtctgcaaaattcattcaaaagataaagttgatct |
235 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| |
|
|
| T |
6909442 |
gtctgcaaaattcattcaaaagtttaagttgatct |
6909408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1315 times since January 2019
Visitors: 3844