View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0583_high_98 (Length: 253)

Name: NF0583_high_98
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0583_high_98
NF0583_high_98
[»] chr4 (3 HSPs)
chr4 (1-157)||(42393200-42393356)
chr4 (1-148)||(42376657-42376804)
chr4 (1-157)||(42387044-42387200)


Alignment Details
Target: chr4 (Bit Score: 141; Significance: 5e-74; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 42393356 - 42393200
Alignment:
1 gggattataaagggaatgactttaattatttcccctttggttctggaagaaggatatgtgatggaatagcaatggctgagagaaatgttttatactttat 100  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| ||||||||    
42393356 gggattataaagggaatgacttcaattatttcccctttggttctggaagaaggatatgtgctggaatagcaatggctgagaggaatgttttgtactttat 42393257  T
101 agccacccttatgcactcgtttgattggacaatacctcaaggagaaaagttggatgt 157  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42393256 agccacccttatgcactcgtttgattggacaatacctcaaggagaaaagttggatgt 42393200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 42376804 - 42376657
Alignment:
1 gggattataaagggaatgactttaattatttcccctttggttctggaagaaggatatgtgatggaatagcaatggctgagagaaatgttttatactttat 100  Q
    |||||||||  ||||||||||| || |||||||| ||||| |||||||||||||| ||||  |||||||||||||||||||| |  ||||| |||||| |    
42376804 gggattatagtgggaatgacttcaactatttcccttttggctctggaagaaggatttgtgccggaatagcaatggctgagaggacggttttgtactttgt 42376705  T
101 agccacccttatgcactcgtttgattggacaatacctcaaggagaaaa 148  Q
    |||||||||| |||||| ||||||||||||| | ||||||||||||||    
42376704 agccacccttgtgcacttgtttgattggacagttcctcaaggagaaaa 42376657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 42387200 - 42387044
Alignment:
1 gggattataaagggaatgactttaattatttcccctttggttctggaagaaggatatgtgatggaatagcaatggctgagagaaatgttttatactttat 100  Q
    |||||||||  ||||||||||| || |||||||| ||||| |||||||||||||| ||||  |||||||||||| ||||||| |  ||||| |||||| |    
42387200 gggattatagtgggaatgacttcaactatttcccttttggctctggaagaaggatttgtgccggaatagcaatgtctgagaggacggttttgtactttgt 42387101  T
101 agccacccttatgcactcgtttgattggacaatacctcaaggagaaaagttggatgt 157  Q
    |||||||||| |||||| ||||||||||||| | ||||||||||||||  |||||||    
42387100 agccacccttgtgcacttgtttgattggacagttcctcaaggagaaaatatggatgt 42387044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1072 times since January 2019
Visitors: 3839