View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_101 (Length: 315)
Name: NF0583_low_101
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0583_low_101 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 71; Significance: 4e-32; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 39185401 - 39185319
Alignment:
Q |
1 |
tgtatcttcgaattcgagtttgggactcttaggattggggtttatatcgttctgttgggtctctgagacttgctgctattgct |
83 |
Q |
|
|
|||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39185401 |
tgtatctttgaattcgagtttgggtctcttaggattggggtttctatcgttctgttgggtctctgagacttgctgctattgct |
39185319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1170 times since January 2019
Visitors: 3841