View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_104 (Length: 311)
Name: NF0583_low_104
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_104 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 13 - 276
Target Start/End: Complemental strand, 47364417 - 47364146
Alignment:
| Q |
13 |
aatatcatatgggattgctttgaaatcaacaaacattctttagtgtacgtagtatctgacagatacagtgacacccaagaatgttgaactttagattttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47364417 |
aatatcatatgggattgctttgaaatcaacaaacattctttagtgtacgtagtatctgacagatacagtgacacccaagaatgttgaactttagattttt |
47364318 |
T |
|
| Q |
113 |
agttactacaatgtgcatatat--------caagatatacttcatgatgagctttttcttttcaaagtgcgggtcttcaggagcatgaaagaaacagact |
204 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47364317 |
agttactacaatgtgcatatatatatatatcaagatatactacattatgagctttttcttttcaaagtgcgggtcttcaggagcatgaaagaaacagact |
47364218 |
T |
|
| Q |
205 |
cactttgttttcattttaaaagagcatctcatggaccccttctattagagcattcacaatggatttatccat |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47364217 |
cactttgttttcattttaaaagagcatctcatggaccccttctattagagcattcacaatggatttatccat |
47364146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1207 times since January 2019
Visitors: 3841