View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_106 (Length: 309)
Name: NF0583_low_106
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0583_low_106 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 43575793 - 43576014
Alignment:
Q |
1 |
tgtaattttttctattttgtgtgataactctaccatggcgtacttttcaaatatgaaaaagatgaattagatactataataattagaaaatatatttttc |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43575793 |
tgtaattttttctattttgtgtgataactctaccatggcatacttttcaaatatgaaaaagatgaattagatactataataattagaaaatatatttttc |
43575892 |
T |
 |
Q |
101 |
atatatatcattaaggttagatattatgacaggacttttgcacgaaaaagaggtacctatgaacataattttctttggtaataactcttcctcaatccaa |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43575893 |
atatatatcattaaggttagatattatgacaggacttttgcacgaaaaagaggtacctatgaacataattttctttggtaataactcttcctcaatccaa |
43575992 |
T |
 |
Q |
201 |
gactcaggttatatggggaaaa |
222 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
43575993 |
gactcaggttatatggggaaaa |
43576014 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University