View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_107 (Length: 309)
Name: NF0583_low_107
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_107 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 69 - 309
Target Start/End: Complemental strand, 40405660 - 40405420
Alignment:
| Q |
69 |
cagagactaagcacccttcttgcattttacaatattatatgaaattgaaagtttaggttaagannnnnnnnnnnnnnnnnnnnnnnnncccggtcatgga |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
40405660 |
cagagactaagcacccttcttgcattttacaatattatatgaaattgatagtttaggttaagattttttctttttcaatttttattttcccggtcatgga |
40405561 |
T |
 |
| Q |
169 |
tcccatgttaaaatcagactttgctaccagcacctccacctgcacgattggaatcggttccaatcttcacaacatcaattatatgaccaccactcaactc |
268 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40405560 |
tcccatgttaaaatcagactttgctaccggcacctccacctgcacgattgggatctgttccaatcttcacaacatcaattatatgaccaccactcaactc |
40405461 |
T |
 |
| Q |
269 |
ttgacccttcattggtgcctctaccactggtgtagcatttc |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40405460 |
ttgacccttcattggtgcctctaccactggtgtagcatttc |
40405420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University