View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_108 (Length: 302)
Name: NF0583_low_108
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_108 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 52 - 221
Target Start/End: Original strand, 15115041 - 15115210
Alignment:
| Q |
52 |
tggtgggttcgttgttgatgagggagaggagagcgaggagaggtttgagattcttttcgcgttcgacggcgtggtcgaggccgcggtcgcggacaagggt |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15115041 |
tggtgggttcgttgttgatgagggagaggagagtgaggagaggtttgagattcttttcgcgttcgacggcgtggtcgaggccgcggtcgcggacgagggt |
15115140 |
T |
|
| Q |
152 |
gaatgtgccggagaagagagtgcggagatggtggcggtgggcagtagcggtggtgtggcggagggagaag |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15115141 |
gaatgtgccggagaagagagtgcggagatggtggcggtgggcagtaggggtggtgtggcggagggagaag |
15115210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 642 times since January 2019
Visitors: 3837