View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_109 (Length: 302)
Name: NF0583_low_109
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0583_low_109 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 30 - 268
Target Start/End: Original strand, 40269551 - 40269789
Alignment:
Q |
30 |
agatttacttgcaatcactacccgtattggttgaaacgaatttttccaacaagtagtttttgttaatcctttnnnnnnngtagttttctttaatgacatt |
129 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |
|
|
T |
40269551 |
agatttacttgcaatcacaccccgtattggttgaaacgaatttttccaacaagtagtttttgttaatcctttaaaaaaagtagttttctttaatgacgtt |
40269650 |
T |
 |
Q |
130 |
aaagacttaaacaacatttactttgtcattttcaaaccaaatgtctaggttgcgtgcattgttttctgcagattgaggttgtcacaacccctctagggtt |
229 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40269651 |
aaagacttcaacaacatttactttgtcattttcaaaccaaatgtctaggttgcgtgcattgttttctgcagattgaggttgtcacaacccctctagggtt |
40269750 |
T |
 |
Q |
230 |
gtgaacggtgttcctcgcacaaacaaacatttactcaac |
268 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
40269751 |
gtgaacggtgttcgtcgcacaaacaaacatttactcaac |
40269789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University