View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_111 (Length: 300)
Name: NF0583_low_111
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_111 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 29289585 - 29289824
Alignment:
| Q |
1 |
tagttgtcaaggtcatacactcataattgcccataatcattcaggtttacactttacacaaaagcaccaacctgtttagttttgcttttatctttttgca |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29289585 |
tagttgtcaaggtcgtacactcataattgcccataatcattcaggtttacactttacacaaaagcaccaacctgtttagttttgcttttatctttttgca |
29289684 |
T |
|
| Q |
101 |
ttatatctttggtggcatatctctcactcattcacaaaaataatatacctatcttttcaatagattgtgatcaaaatttctgcatatattactcttccac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29289685 |
ttatatctttggtggcatatctctcactcattgacaaaaataatatacctatctattcaatagattatgatcaaaatttctgcatatattactcttccac |
29289784 |
T |
|
| Q |
201 |
attagattttggtgtcaaataaattatatcacttgttcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29289785 |
attagattttggtgtcaaataaattatatcacttgttcat |
29289824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 29284282 - 29284520
Alignment:
| Q |
1 |
tagttgtcaaggtcatacactcataattgcccataatcattcaggtttacactttacacaaaagcaccaacctgtttagttttgcttttatctttttgca |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29284282 |
tagttgtcaaggtcgtacactcataattgcccataatcattcaggtttacactttacacaaaagcaccaacctgtttagttttgcttttatctttttgca |
29284381 |
T |
|
| Q |
101 |
ttatatctttggtggcatatctctcactcattcacaaaaataatatacctatcttttcaatagattgtgatcaaaatttctgcatatattactcttccac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29284382 |
ttatatctttggtggcatatctctcactcattgacaaaaataatatacctatctattcaatagattatgatcaaaatttctgcatatattactcttccac |
29284481 |
T |
|
| Q |
201 |
attagattttggtgtcaaataaattatatcacttgttca |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29284482 |
attagattttggtgtcaaataaattatatcacttgttca |
29284520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 846 times since January 2019
Visitors: 3837