View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0583_low_112 (Length: 297)

Name: NF0583_low_112
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0583_low_112
NF0583_low_112
[»] chr4 (1 HSPs)
chr4 (68-237)||(36227031-36227200)


Alignment Details
Target: chr4 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 68 - 237
Target Start/End: Original strand, 36227031 - 36227200
Alignment:
68 tggcttcaaatattgaattacttcggaggggtttatcggcgaattccgggtattcaatctcttttttcgggctttgccgggctcttccctttcctttgat 167  Q
    |||||||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||    
36227031 tggcttcaaatattgaattacttcagaggggtttatcggcaaattccgagtattcaatctcttttttcgggctttgtcgggctcttccctttcctttgat 36227130  T
168 aaatttcctcctacaagctcttgaaagtctttgactaagccttcttcccgctctactggaaactttccaa 237  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36227131 aaatttccccctacaagctcttgaaagtctttgactaagccttcttcccgctctactggaaactttccaa 36227200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University