View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_114 (Length: 292)
Name: NF0583_low_114
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_114 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 67 - 186
Target Start/End: Original strand, 19475343 - 19475462
Alignment:
| Q |
67 |
taccaagttataaaactaacattgtgatgcttggtgatggaagtgattctactgtcatcactggtaacagaagtgttgttgatggatggaccactttcag |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19475343 |
taccaagttataaaactaacattgtgatgcttggtgatggaagtgattctactgtcatcactggtaacagaagtgttgttgatggatggaccactttcag |
19475442 |
T |
 |
| Q |
167 |
atctgcaactttaggtgaag |
186 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
19475443 |
atctgcaactttaggtgaag |
19475462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 96 - 182
Target Start/End: Original strand, 51547480 - 51547566
Alignment:
| Q |
96 |
cttggtgatggaagtgattctactgtcatcactggtaacagaagtgttgttgatggatggaccactttcagatctgcaactttaggt |
182 |
Q |
| |
|
|||||||||||||| ||| |||||||| ||||| || ||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51547480 |
cttggtgatggaagggatcaaactgtcattactggcaatagaagtgatgttgatggatggaccaccttcagatctgcaactttaggt |
51547566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University