View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_129 (Length: 282)
Name: NF0583_low_129
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_129 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 44 - 229
Target Start/End: Complemental strand, 50741229 - 50741044
Alignment:
| Q |
44 |
atagggttcgatcatatggaatgaaggtgatgcttactctttttcatcactcacttccaccctgggccggtgattatggaggttggaagctggaaaagac |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50741229 |
atagggttcgatcatatggaatgaaggtgatgcttactctttttcatcactcacttccaccctgggccggtgattatggaggttggaagctggaaaagac |
50741130 |
T |
|
| Q |
144 |
agtggattatttcatggattttaccaggtagtttttcctttagtggcatttgtttgtatgccatcgaactctgcctgatgatgatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
50741129 |
agtggattatttcatggattttaccaggtagtttttcctttagtggcatttgtttgtatgccatcgaactctgcctgctgaggatg |
50741044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 754 times since January 2019
Visitors: 3837