View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0583_low_129 (Length: 282)

Name: NF0583_low_129
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0583_low_129
NF0583_low_129
[»] chr4 (1 HSPs)
chr4 (44-229)||(50741044-50741229)


Alignment Details
Target: chr4 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 44 - 229
Target Start/End: Complemental strand, 50741229 - 50741044
Alignment:
44 atagggttcgatcatatggaatgaaggtgatgcttactctttttcatcactcacttccaccctgggccggtgattatggaggttggaagctggaaaagac 143  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50741229 atagggttcgatcatatggaatgaaggtgatgcttactctttttcatcactcacttccaccctgggccggtgattatggaggttggaagctggaaaagac 50741130  T
144 agtggattatttcatggattttaccaggtagtttttcctttagtggcatttgtttgtatgccatcgaactctgcctgatgatgatg 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||    
50741129 agtggattatttcatggattttaccaggtagtttttcctttagtggcatttgtttgtatgccatcgaactctgcctgctgaggatg 50741044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 754 times since January 2019
Visitors: 3837