View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_138 (Length: 280)
Name: NF0583_low_138
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0583_low_138 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 35 - 185
Target Start/End: Complemental strand, 11438845 - 11438695
Alignment:
Q |
35 |
aggagcagagaaatgttgtaacttcttcttcttgtttcagcatgttgttgatctcttgaggatgttgttcgatctggttcctggttttgggtcggtgggt |
134 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |
|
|
T |
11438845 |
aggagcagagaagtgttgtaacttcttcttcttgtttcaacatgttgttgatctcttgaggatgttgttcgatctagttcctggttttgggtcggtggat |
11438746 |
T |
 |
Q |
135 |
cgtgtggatcccttggctgattgggttaaggattcgtagcatgtctgccga |
185 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
11438745 |
cgtgtggatcccttggctggttgggttaaggattcgtagcatgtctgccga |
11438695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University