View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_139 (Length: 280)
Name: NF0583_low_139
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0583_low_139 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 39 - 146
Target Start/End: Complemental strand, 25294049 - 25293942
Alignment:
Q |
39 |
agcatagggtggagatggtgtcgccgagggtgcgatttgggaggtaatagttggggcagaggctgaagtccatgaagatgcggtcggtgatggtggggtt |
138 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25294049 |
agcatagggtggagatggtgtcgccgagggtgcgatttgggaggtaatagttggggcagaggctgaagtccatgaagatgcggtcggtgatggtggggtt |
25293950 |
T |
 |
Q |
139 |
tggtagct |
146 |
Q |
|
|
|||||||| |
|
|
T |
25293949 |
tggtagct |
25293942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University