View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0583_low_139 (Length: 280)

Name: NF0583_low_139
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0583_low_139
NF0583_low_139
[»] chr2 (1 HSPs)
chr2 (39-146)||(25293942-25294049)


Alignment Details
Target: chr2 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 39 - 146
Target Start/End: Complemental strand, 25294049 - 25293942
Alignment:
39 agcatagggtggagatggtgtcgccgagggtgcgatttgggaggtaatagttggggcagaggctgaagtccatgaagatgcggtcggtgatggtggggtt 138  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25294049 agcatagggtggagatggtgtcgccgagggtgcgatttgggaggtaatagttggggcagaggctgaagtccatgaagatgcggtcggtgatggtggggtt 25293950  T
139 tggtagct 146  Q
    ||||||||    
25293949 tggtagct 25293942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1003 times since January 2019
Visitors: 3839