View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_141 (Length: 278)
Name: NF0583_low_141
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_141 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 51 - 238
Target Start/End: Complemental strand, 50214479 - 50214292
Alignment:
| Q |
51 |
tcatcaaggtcatagtcagtcttgtgtctgctggtataataaagggatccttgttccacagagtgcctgttcttgggacgagcatgctcttctactacac |
150 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50214479 |
tcatcaaggtcatagtcagtcttgtgtctactggtataataaagggatccttgttccacagagtgcctgttcttgggacgagcatgctcttctactacac |
50214380 |
T |
|
| Q |
151 |
tgcgagaacgagacctatcccttgtatgaccaattgatcttgatcgacttctgtgtccatcatgcaaaggagaattcgctgacattct |
238 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50214379 |
tacgagaacgagacctatcccttgtatgaccaattgatcttgatcgacttctgtgtccatcatgcaaaggagaattcgctgacattct |
50214292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 821 times since January 2019
Visitors: 3837