View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_143 (Length: 277)
Name: NF0583_low_143
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_143 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 9 - 266
Target Start/End: Complemental strand, 21145192 - 21144935
Alignment:
| Q |
9 |
tcttgccttcatacaattatggaaaaagttggtgttagaatccccttttttaagccacttgatacgagatctttgcaccaccaatgaatcttttgcttta |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21145192 |
tcttgccttcatacaattatggaaaaagttggtgttagaatccccttctttaagccacttgatacgagatctttgcaccaccaatgaatcttttgcttta |
21145093 |
T |
 |
| Q |
109 |
agaagactccataaagcacaaattttttcttttcagactcggacatcttcatcactcaacaacgacaactctccccttaaatccacctcttgtacatctt |
208 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21145092 |
agaagactccataaagcacaaaaattttcttttcggactcggacatcttcatcattcaacaacgacaactctccccttaaatccacctcttgtatatctt |
21144993 |
T |
 |
| Q |
209 |
cttttaacctagaaattctctcttacatcgaaccatgctcctccttgttccactctct |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21144992 |
cttttaacctagaaattctctcttacatcgaaccatactcctccttgttccactctct |
21144935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University