View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_144 (Length: 275)
Name: NF0583_low_144
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0583_low_144 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 4 - 267
Target Start/End: Original strand, 27609322 - 27609585
Alignment:
Q |
4 |
acaattgccctctggtccttttctatagtggttggacttgaatttgtccttgattgattccataattgacactttccaatacccttcagtgatgtttgag |
103 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
27609322 |
acaattgccctctggtccttttctatagtggttggacttgaatttgtccttgattgattccataattgacactttccaatacccttcagtgacgtttgag |
27609421 |
T |
 |
Q |
104 |
cataatgcatcagtgaagcaataatattgtctgatctaacccccattcttcccatggcacatataactctctggtagaaatcgatacgcagtatcgagag |
203 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27609422 |
cataatgcatcagtgaagcaataatattgtctgatctaacccccattcttcccatggcacatataactctctggtagaaatcgatacgcagtatcgagag |
27609521 |
T |
 |
Q |
204 |
atcttcaatccaccatgccacgcactcatcctttatttccttagattcaccatcacagtataat |
267 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
27609522 |
atcttcaatccaccatgctacgcactcatcctttatttccttagattcaccatcacagtgtaat |
27609585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 662 times since January 2019
Visitors: 3837