View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0583_low_146 (Length: 272)

Name: NF0583_low_146
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0583_low_146
NF0583_low_146
[»] chr1 (1 HSPs)
chr1 (98-272)||(10258733-10258907)


Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 98 - 272
Target Start/End: Complemental strand, 10258907 - 10258733
Alignment:
98 atgaaggccctccaattctttaggaacgctcatagatttacgttcaggtgaagcaattgttcctatttcggcattcaccggaacaagagcaccacttttg 197  Q
    |||||||||||| |||||||||||||||| ||||||||| ||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||    
10258907 atgaaggccctctaattctttaggaacgcacatagatttgcgttcaggtgaagcaaccattcctatttcggcattcaccggaacaagagcaccacttttg 10258808  T
198 ctatctagacccaaaaattgatctttatcgaaggaaagatttctagagggcaactgcattgcccattggaccact 272  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
10258807 ctatctagacccaaaaattgatctttatcaaaggaaagatttctagagggcaactgcattgcccattggaccact 10258733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University