View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_148 (Length: 270)
Name: NF0583_low_148
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_148 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 35 - 241
Target Start/End: Original strand, 41721879 - 41722084
Alignment:
| Q |
35 |
gatggacatcatcacatacagtactctctgtccacaatattaaatgaatagtttttagannnnnnnnnnatgtgttaatacatttgtttattgagaatgt |
134 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
41721879 |
gatgtacaccatcacatacagtactctctgtccacaatattaaatgaatagtttttagattttttttt-atgtgttaatacatttgtttatcgagaatgt |
41721977 |
T |
 |
| Q |
135 |
ctgctcttaattgctgttttgtatatctttaatttagtatttattgtttgatatcatagcataccatccttaatgctttatgctcaatcaaaatttgtcc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41721978 |
ctgctcttaattgctgttttgtatatctttaatttagtatttattgtttgatatcatagcataccatccttaatgctttatgctcaatcaaaatttgtcc |
41722077 |
T |
 |
| Q |
235 |
ttctgtg |
241 |
Q |
| |
|
|| |||| |
|
|
| T |
41722078 |
ttttgtg |
41722084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University