View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_152 (Length: 267)
Name: NF0583_low_152
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_152 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 27 - 267
Target Start/End: Complemental strand, 6909948 - 6909708
Alignment:
| Q |
27 |
caaaggttattaaagacgtgtatattccctcttgaacttaccttgcaaaacaacaaatgcaaaaatgtgcaagtaaccatcaactttttcatcacactca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6909948 |
caaaggttattaaagacgtgtatattccctcttgaacttaccttgcaaaacaacaaatgcaaaaatgtgcaagtaaccatcaactttttcatcccactca |
6909849 |
T |
 |
| Q |
127 |
caattcaaacataacttatccctttcaatgcacttcctccatatgcaaagaataggatgttgaatttatccactcaaaattttaaagagttaaacatatt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6909848 |
caattcaaacataacttatccctttcaatgcacttcctccatatgcaaagaataggatgttgaatttatccactcaaaattttaaagagttaaacatatt |
6909749 |
T |
 |
| Q |
227 |
tttagttcgtataaaattataataagttgtttttagtatct |
267 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6909748 |
tttagttcttataaaattataataagttgtttttagtatct |
6909708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University