View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0583_low_163 (Length: 255)

Name: NF0583_low_163
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0583_low_163
NF0583_low_163
[»] chr4 (1 HSPs)
chr4 (6-255)||(54416485-54416735)


Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 6 - 255
Target Start/End: Complemental strand, 54416735 - 54416485
Alignment:
6 aggagcagagaaaagcaaacgttctgctaacaccaaaattctttgacaaacggaaagtataacccgttggccaatatagggcgcacttccaagtttacgg 105  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
54416735 aggatcagagaaaagcaaacgttctgctaacaccaaaattctttgacaaactgaaagtataacccgttggccaatatagggcgcacttccaagtttacgg 54416636  T
106 accaaatgctgaatacagaactgtgcattggtgccactgtcttgagatcctacgaagatacgattttgtaaagat-nnnnnnnnggaacaaaaagaccat 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||    
54416635 accaaatgctgaatacagaactgtgcattggtgccactgtcttgagatcctacgaagatacgattttgtaaagataaaaaaaaaggaacaaaaagaccat 54416536  T
205 taattagagtagataagaaatgaaaatagtatttaatggttaagcttcaga 255  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
54416535 taattagagtagataagaaatgaaaatagtatttaatggttaagcttcaga 54416485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 744 times since January 2019
Visitors: 3837