View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_163 (Length: 255)
Name: NF0583_low_163
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0583_low_163 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 6 - 255
Target Start/End: Complemental strand, 54416735 - 54416485
Alignment:
Q |
6 |
aggagcagagaaaagcaaacgttctgctaacaccaaaattctttgacaaacggaaagtataacccgttggccaatatagggcgcacttccaagtttacgg |
105 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54416735 |
aggatcagagaaaagcaaacgttctgctaacaccaaaattctttgacaaactgaaagtataacccgttggccaatatagggcgcacttccaagtttacgg |
54416636 |
T |
 |
Q |
106 |
accaaatgctgaatacagaactgtgcattggtgccactgtcttgagatcctacgaagatacgattttgtaaagat-nnnnnnnnggaacaaaaagaccat |
204 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
54416635 |
accaaatgctgaatacagaactgtgcattggtgccactgtcttgagatcctacgaagatacgattttgtaaagataaaaaaaaaggaacaaaaagaccat |
54416536 |
T |
 |
Q |
205 |
taattagagtagataagaaatgaaaatagtatttaatggttaagcttcaga |
255 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54416535 |
taattagagtagataagaaatgaaaatagtatttaatggttaagcttcaga |
54416485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 744 times since January 2019
Visitors: 3837