View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_166 (Length: 254)
Name: NF0583_low_166
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_166 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 7181975 - 7182219
Alignment:
| Q |
1 |
gttgccctactactgttgttacaatttcaagaatttgcactttattttattttaaaaatttgcaactgtaaattctttatgctcactttgacacccaaan |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7181975 |
gttgccctactactgttgttacaatttcaagaatttgcactttattttattttaaaaatttgcaactgtaaattctttatgctcactttgacacccaaat |
7182074 |
T |
 |
| Q |
101 |
nnnnnngttaaaacttcgccacagtttctagaaaataattctaatgatataattatgaggggacaacaatattttagttttcctgaaatactcaaaatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7182075 |
ttttttgttaaaacttcgccacagtttctagaaaataattctaatgatataattatgaggggacaacaatattttagttttcttgaaatactcaaaatct |
7182174 |
T |
 |
| Q |
201 |
caaggggggacttgatttacatttgacaaatttctgcagtataatct |
247 |
Q |
| |
|
||| | ||||||||| |||||||||||| ||||||| || ||||||| |
|
|
| T |
7182175 |
caa-gtgggacttga-ttacatttgacacatttctggagaataatct |
7182219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University