View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_167 (Length: 253)
Name: NF0583_low_167
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_167 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 5e-74; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 42393356 - 42393200
Alignment:
| Q |
1 |
gggattataaagggaatgactttaattatttcccctttggttctggaagaaggatatgtgatggaatagcaatggctgagagaaatgttttatactttat |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
42393356 |
gggattataaagggaatgacttcaattatttcccctttggttctggaagaaggatatgtgctggaatagcaatggctgagaggaatgttttgtactttat |
42393257 |
T |
 |
| Q |
101 |
agccacccttatgcactcgtttgattggacaatacctcaaggagaaaagttggatgt |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42393256 |
agccacccttatgcactcgtttgattggacaatacctcaaggagaaaagttggatgt |
42393200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 42376804 - 42376657
Alignment:
| Q |
1 |
gggattataaagggaatgactttaattatttcccctttggttctggaagaaggatatgtgatggaatagcaatggctgagagaaatgttttatactttat |
100 |
Q |
| |
|
||||||||| ||||||||||| || |||||||| ||||| |||||||||||||| |||| |||||||||||||||||||| | ||||| |||||| | |
|
|
| T |
42376804 |
gggattatagtgggaatgacttcaactatttcccttttggctctggaagaaggatttgtgccggaatagcaatggctgagaggacggttttgtactttgt |
42376705 |
T |
 |
| Q |
101 |
agccacccttatgcactcgtttgattggacaatacctcaaggagaaaa |
148 |
Q |
| |
|
|||||||||| |||||| ||||||||||||| | |||||||||||||| |
|
|
| T |
42376704 |
agccacccttgtgcacttgtttgattggacagttcctcaaggagaaaa |
42376657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 42387200 - 42387044
Alignment:
| Q |
1 |
gggattataaagggaatgactttaattatttcccctttggttctggaagaaggatatgtgatggaatagcaatggctgagagaaatgttttatactttat |
100 |
Q |
| |
|
||||||||| ||||||||||| || |||||||| ||||| |||||||||||||| |||| |||||||||||| ||||||| | ||||| |||||| | |
|
|
| T |
42387200 |
gggattatagtgggaatgacttcaactatttcccttttggctctggaagaaggatttgtgccggaatagcaatgtctgagaggacggttttgtactttgt |
42387101 |
T |
 |
| Q |
101 |
agccacccttatgcactcgtttgattggacaatacctcaaggagaaaagttggatgt |
157 |
Q |
| |
|
|||||||||| |||||| ||||||||||||| | |||||||||||||| ||||||| |
|
|
| T |
42387100 |
agccacccttgtgcacttgtttgattggacagttcctcaaggagaaaatatggatgt |
42387044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University