View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_168 (Length: 253)
Name: NF0583_low_168
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0583_low_168 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 24 - 194
Target Start/End: Original strand, 4858504 - 4858675
Alignment:
Q |
24 |
caaacaagtgtgattgtgactattgagctatgttatgttcacgtaacaagcttttacatacaataaattgtacattgaattcagaataaataaaagatgt |
123 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
4858504 |
caaacaagtgtgattgtgactattgag-tatgttatgttcacgtaacaagcttttacatacaataaattgtacattgaattctgaataaataaaagatgt |
4858602 |
T |
 |
Q |
124 |
attgttatcaaatatcaaagaaaatac--nnnnnnnnngaaggaaaaagaaaatacattgtaaaggtcaattt |
194 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
4858603 |
attgttatcaaatatcaaagaaaatacatattttttttgaaggaaaaagaaaatacattgtaaaggtcaattt |
4858675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 58 times since January 2019
Visitors: 3831