View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_171 (Length: 252)
Name: NF0583_low_171
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0583_low_171 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 36882344 - 36882456
Alignment:
Q |
1 |
aaattgcttataattgagactagaggatgtaattatcatgtttcactctgagaagccaaatccctannnnnnnnatttaagtggaaataaaatcgtatct |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
T |
36882344 |
aaattgcttataattgagactagaggatgtaattatcatgtttcactctgagaagccaagtcccta-tttatttatttaagtggaaataaaatcgtatct |
36882442 |
T |
 |
Q |
101 |
ttccatattcaacc |
114 |
Q |
|
|
|||||||||||||| |
|
|
T |
36882443 |
ttccatattcaacc |
36882456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 172 - 225
Target Start/End: Original strand, 36882480 - 36882533
Alignment:
Q |
172 |
gctcattcgtatttcttttccttccacaggtgacacaagcaatctcgtgtagtg |
225 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36882480 |
gctcattcgtatttcttttccttccacaggtgacacaagcaatctcgtgtagtg |
36882533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University