View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_172 (Length: 252)
Name: NF0583_low_172
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_172 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 28 - 250
Target Start/End: Original strand, 12030793 - 12031015
Alignment:
| Q |
28 |
catgacaacgattgcaaccttaaagttttttctaaaaatatgtgaccacggttgcagttgttatccacaactttttgtaataccaaaggtcacaattaac |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12030793 |
catgacaacgattgcaaccttaaagttttttctaaaaatatgtgaccacggttgcagttgttatccacaactttttgtaataccaaagatcacaattaac |
12030892 |
T |
 |
| Q |
128 |
tactatggttatagcaaaggagccattattttagcttggcaaagatgcttgagttagccaagagatgttggtccaatcaataagtaattcgttcatattt |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12030893 |
tactatggttatagcaaaggagccatcattttagcttggcaaagatgcttgagttagccaagagatgttggtccaatcaataagtatttcgttcatattt |
12030992 |
T |
 |
| Q |
228 |
tagaaaggtgtaagttcaactcc |
250 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
12030993 |
tagaaaggtgtaagttcaactcc |
12031015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University