View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0583_low_183 (Length: 246)

Name: NF0583_low_183
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0583_low_183
NF0583_low_183
[»] chr1 (1 HSPs)
chr1 (1-123)||(29937731-29937854)


Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 29937731 - 29937854
Alignment:
1 gtattatttggacgaagaaatcaataaaagaagcttgttaatttctgccatggtgacattggtcaagagtcatctcttaattttattagtatcaactaac 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||    
29937731 gtattatttggacgaagaaatcaataaaagaagcttgttaatttctgccatggtgacattggtcaagagtcatctcttcaatttattagtatcaactaac 29937830  T
101 -tactactccaataccagtattat 123  Q
     |||||||||||||| ||||||||    
29937831 ttactactccaatactagtattat 29937854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University