View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_183 (Length: 246)
Name: NF0583_low_183
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_183 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 29937731 - 29937854
Alignment:
| Q |
1 |
gtattatttggacgaagaaatcaataaaagaagcttgttaatttctgccatggtgacattggtcaagagtcatctcttaattttattagtatcaactaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
29937731 |
gtattatttggacgaagaaatcaataaaagaagcttgttaatttctgccatggtgacattggtcaagagtcatctcttcaatttattagtatcaactaac |
29937830 |
T |
 |
| Q |
101 |
-tactactccaataccagtattat |
123 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
29937831 |
ttactactccaatactagtattat |
29937854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University