View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_195 (Length: 220)
Name: NF0583_low_195
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_195 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 45 - 220
Target Start/End: Original strand, 1755527 - 1755702
Alignment:
| Q |
45 |
acaattttaacgaccaagaaagattcgatcaagtagccagtgtctcgttattattatgcttgttgttgatcctcttccctgccttaaaggctgcaacaga |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1755527 |
acaattttaacgaccaagaaagattcgatcaagtagccagtgtctcgttattattatgcttgttgctgatcctcttccctgccttaaaggctgcaacaga |
1755626 |
T |
|
| Q |
145 |
tggcgataacattgcaaaacatcacactttcctgacaatttaccacaccacttttgttttggtgaatcagtcatat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1755627 |
tggcgataacattgcaaaacatcacactttcctgacaatttaccacaccacttttgttttggtgaatcagtcatat |
1755702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 45 - 220
Target Start/End: Complemental strand, 1766223 - 1766048
Alignment:
| Q |
45 |
acaattttaacgaccaagaaagattcgatcaagtagccagtgtctcgttattattatgcttgttgttgatcctcttccctgccttaaaggctgcaacaga |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1766223 |
acaattttaacgaccaagaaagattcgatcaagtagccagtgtctcgttattattatgcttgttgctgatcctcttccctgccttaaaggctgcaacaga |
1766124 |
T |
|
| Q |
145 |
tggcgataacattgcaaaacatcacactttcctgacaatttaccacaccacttttgttttggtgaatcagtcatat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1766123 |
tggcgataacattgcaaaacatcacactttcctgacaatttaccacaccacttttgttttggtgaatcagtcatat |
1766048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1171 times since January 2019
Visitors: 3841