View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_198 (Length: 216)
Name: NF0583_low_198
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0583_low_198 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 38995593 - 38995725
Alignment:
| Q |
1 |
aagaacacaacataatttctcaaacctttaacataaaaatggaaatcaaagttttaagatgaaacctnnnnnnnntatggagctaaaacataaagaaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38995593 |
aagaacacaacataatttctcaaacctttaacataaaaatggaaatcaaagttttaagatgaaacctaaaaaaaatatggagctaaaacataaagaaaaa |
38995692 |
T |
|
| Q |
101 |
gaagaatccccatcatccacacatcgttctgtg |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38995693 |
gaagaatccccatcatccacacatcgttctgtg |
38995725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 595 times since January 2019
Visitors: 3836