View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0583_low_202 (Length: 208)
Name: NF0583_low_202
Description: NF0583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0583_low_202 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 37858955 - 37858864
Alignment:
Q |
1 |
gtatggtgatgaagtgagtgaggaagaatgtgttgagaaggtggaagatgagatgggtgtgactaagtttggaagaccaagaaggtgcaaag |
92 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37858955 |
gtatggtgatgaagtgagtgaggaagagtgtgttgagaaggtggaagatgagatgggtgtgactaagtttggaagaccaagaaggtgcaaag |
37858864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 893 times since January 2019
Visitors: 3837